With the White Rabbit Down the Hole. The Spread and Legacy of a Coastal DNA
- Hans Faber
- Jul 22, 2020
- 18 min read
Updated: Feb 1

R1b/Hg1/Eu18; R-M213; R-M9; R1b-M45; R-M207; R-M173; R-M343; R-L278; R-L754; R-L389/R1b1a1; R-M415; R-P297/R1b1a1a; R-M269/R1b1a1a2; R-M520; R-L23; R-M412; R-L11; R-S21/U106/M405/R1b1a1a1a2a1a1... Knock Knock… Wake up Neo… Follow the White Rabbit…|
These serial numbers, arranged in chronological order, represent groups and subgroups of people who genetically share a common ancestor. Pulling on these protein strands is like tumbling down the rabbit hole: they lead from the Old Stone Age into the Middle Bronze Age, from 20,000–15,000 years ago to 4,500–4,000 years ago, from the brackish shores of the Caspian Sea to the murky southern coasts of the North Sea. It was along these cold, muddy waters that the genetic common ancestor of the Germanic peoples once lived. Remarkably, the highest concentration of this specific DNA today is found precisely in the region covered by the Frisia Coast Trail. Some even speak of a "Frisian branch” (Eupedia.com 2011).
So, the truly irrelevant question arises:
Is Frisia the cradle of the Germanic peoples?
This blog post deals with genetics, a field in which developments move at a rapid pace. It is nearly impossible to keep up. We therefore repeat a cautionary note we once came across on the web regarding genetics: “Everything presented in this document is wrong. The question is: how wrong?” (MacDonald 2015).
Trying to make sense of the language geneticists use is like trying to decode The Matrix. That is why people so easily end up copying existing texts from the web. As Dawkins (1976) reminds us, this is exactly how memes behave: ideas or cultural concepts replicating themselves through people’s minds. Take the one from 2020 claiming that the 5G network caused COVID-19. Before you know it, everyone starts believing it—just as our selfish genes propagate themselves. In today’s jargon of policymakers and reporters, memeing goes by the more respectable name of 'framing.' Yeah, you get the idea by now.
The immediate reason for us, Frisian bastards, to take a closer look at the so-called 'Frisian branch' DNA was the blog post Genetic Maps of Europe published by the blog The Dockyards in the summer of 2020. That blog post, however, turned out to be little more than a replication—indeed, a meme—of information already circulating on the community platform Eupedia.com, which hosts a dedicated section on the genetics of Europe. Unfortunately, Eupedia.com also offers no solid references regarding the 'Frisian branch,' though its visual presentation is undeniably impressive. You are almost persuaded of its accuracy without reading a single syllable.
So, we descended further down the hole in search of the sources on which this Frisian branch theory is supposed to rest. Browsing for 'Germanic DNA,' we mostly encountered more-or-less recycled texts claiming that this genetic group was (proto-)Germanic, that it originated along the shores of the Netherlands and northwest Germany, and that it is about 2,500 years old. In other words, a meme—or a frame. But what is the veracity? Or, to put it differently: what is the least wrong?
We kept following the White Rabbit, trying to leave the countless web parrots behind, and with awe and a hint of reverence we—humble hikers—ventured into articles of genetic science. What we found is set out below. If, however, you are the type who prefers to remain in blissful ignorance, this is the moment to stop reading and swallow the blue pill.
Welcome in Wonderland

Our condolences, you continued reading.
Before we begin, we need to explain two or three things about genetics. Do not worry—we have kept it to the bare minimum, partly so this blog post won’t read like a lecture, and partly because of our own extremely limited grasp of this complex science.
YX and XX
DNA research into the origins of humans can be approached via the male chromosomes or the female chromosomes. The first is the study of the Y chromosome (yDNA), passed from father to son. The second is mitochondrial DNA (mtDNA), passed from mother to child(ren). A third variant is autosomal DNA (atDNA), which concerns the twenty-two non-sex chromosomes, but we will leave atDNA aside. Most genetic research on the origins of peoples concentrates on the Y chromosome, as it is particularly useful for reconstructing population histories (Altena 2019).
Comparing yDNA and mtDNA can reveal striking insights into the (mis)behaviour of males. Take, for example, male African Americans in the United States: their yDNA is on average thirty-three percent European, while their mtDNA shows only about six percent European ancestry. A Snow White–like mirror—this time genetic—reflects back to us the behaviour of European white men during slavery (Shaw 2009).
Comparable male misbehaviour may have occurred during the Anglo-Saxon colonization of England, given their substantial contribution to the English gene pool. Indeed, early Anglo-Saxon society may have operated under apartheid-like structures, limiting the reproductive rights of the native Romano-Celtic population (Thomas 2006). The legendary Frisian brothers Hengist and Horsa were even at the forefront of this aggressive wave of immigration from the south-eastern coast of the North Sea.
Another example of colonial male misbehaviour can be seen in the population of modern Iceland. Male yDNA is predominantly Nordic, while female mtDNA is predominantly Gaelic (O’Sullivan 2018). The Icelandic sagas recount women from Ireland and Scotland being raided by Norwegians—dubbed Vikings—which is now genetically confirmed. Unless, of course, Irish and Scottish women were irresistibly drawn to the Icelandic landscape and voluntarily journeyed to the icy island, taking its uncivilized, strange-speaking Norsemen for granted. We consider this a far less likely scenario. A similar pattern appears on the Faroe Islands, where Scandinavian men and Celtic women dominate the genetic record (Gershon 2021).
For more on this grab-a-woman phenomenon, see also our blog post Latið meg ei á Frísaland fordervast! and The Murder of a Bishop—only this time perpetrated by Frisian pirates operating in the northern seas; all according to Faroese sagas.
Between 1530 and 1780, roughly 1.25 million Europeans were enslaved by North Africans along the so-called Barbary Coast of North Africa. Little research seems to have been done on the DNA footprint of these so-called 'Christian slaves,' perhaps because it is less visible than the examples of African Americans or Anglo-Saxons—Muslim North Africans reportedly took vigorous measures to prevent Christian male slaves from reproducing. The extent to which female white slaves bore children with North African men remains unknown. Yet, around the year 1700, citizens of Algiers were noted for their white complexion (Davis 2003).
Yes, once you are down the Rabbit Hole, there is little Little Miss Sunshine left. Sorry to have popped the bubble now that you have swallowed the red pill.
Haplogroups
A central concept you encounter in genetics is that of haplogroups, sub-haplogroups, and haplotypes. A haplogroup is essentially a collection of haplotypes. Haplotypes are organisms, including humans, that share a common ancestor with a specific chromosomal mutation. Subgroups of a haplogroup are often called clades, subclades, or—if you want to sound especially brainy—single nucleotide polymorphisms (SNPs, pronounced 'snips'). The term 'genetic marker,' or simply 'marker,' is often tossed in for good measure as well.
Since all these genetic (sub)groups are in one way or another subsets of an older DNA lineage—or at least represent a shared genetic variation—we will keep things simple and stick with the term haplogroup in this blog post. No doubt this glosses over all kinds of crucial subtleties, but at least it gives you the feeling you have understood something.
Another difficulty we ran into when delving into the world of genetics is the inconsistent naming of haplogroups. A single haplogroup can easily go by three, four, sometimes even five different names. To make matters worse, those names are always some bewildering mix of letters and numbers. The root of this wild tangle lies in commerce. Private companies, heavily invested in the genetic genealogy business, have created their own naming conventions. Science, predictably and somewhat vainly, resists adopting labels coined by the ruffians of the private sector. After all, nothing good ever comes from commerce.
Try not to resist it. It is too late for the blue pill anyway.
Sign the Times
One final remark concerns the use of time scales and the dating of haplogroups. Geneticists, like geologists, often use the abbreviation BP (Before Present), rather than BC (Before Christ) and AD (Anno Domini), as archaeologists and historians tend to do—or rather than BCE (Before the Common Era) and CE (Common Era), which is used by scholars who want to stay religiously and politically correct inclusive. The BP scale takes the year 1950 as 'Present.' Why 1950? Something to do with radiocarbon dating. Do not bother.
Then there are those who prefer ya (years ago), with k for thousand, m for million, and b for billion. So 9kya means 9,000 years ago. Finally, you have the plain souls of science who simply write “7,500 years ago.” No fancy abbreviations, nothing. Just check when the article was published in, say, science journal Nature, and you know the supposed age of the haplogroup. Or should you take the date when the research was actually carried out a few years earlier?
Anyway, the whole thing is rather like the chaos of countless electric plugs, connectors, and sockets around the world—only without anyone carrying an adapter. We, therefore, decided to stick with BC and AD: familiar to everyone, and fitting enough since we are based in Europe anyway.
Concerning the dating of Y-chromosome lineages, based on mutation rates, this is, unsurprisingly, notoriously difficult—and therefore controversial within science. Age estimates can differ by a staggering factor of three (Busby 2011). Once more, as we noted earlier, the real question is not if it is wrong, but how wrong.
Genetic Europe

Where in the history of genes should we begin this blog post? At the cradle of humankind in Africa, with Lucy? Or perhaps a little further down the road?
We chose to start at the point where the genetic tree splits and haplogroup R1b emerged. About fifty percent of men in Europe today carry the genetic signature of this haplogroup. It originated in West Asia, following three clear genetic splits that took place outside Europe, probably somewhere between 23,500 and 10,500 BC. Not exactly a sharp estimate, as we warned earlier. The two main branches of R1b are R-V88, which migrated into Central Africa, and R-M269, which made its way into Europe.
AGCAACAGGAATGAAACTCCAATGAAAGAAAGAAAAGGAAG/GAAA/GAAA/GAAA/GAAA/GAAAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GGAGGGTGGGCGTGGTG
This is the R-M269 DNA sequence—not someone crying out in agony.
During the Mesolithic Age, or Middle Stone Age, roughly 9,000 to 5,000 BC—though, interestingly, there is no real consensus on the exact dates—people in Europe were hunter-gatherers who had begun to settle and build huts. Before that, in the Palaeolithic Age or Old Stone Age, people more or less just roamed in small groups and took shelter in caves. Farming was still unknown to these captain cavemen of the Mesolithic.
Around 8,000 BC, agricultural techniques, including cattle herding, emerged in the Fertile Crescent of southwest Asia—the combined regions of Assyria, Mesopotamia, the Nile Delta, and Phoenicia. These farmers then began to migrate—what is it with humans, always on the move?—bringing their new technology with them. By about 5,500 BC, they had spread into Europe, triggering a dramatic rise in the European population (Busby 2011). This marked the end of the Mesolithic Age and the start of the Neolithic, or New Stone Age. Indeed: “Wake up, Neo(lithic)…”—and Bedrock cities started springing up like mushrooms.
Drinking Cattle Milk — Domestication of wild aurochs began around 7,000 BC, in the regions of what are now Pakistan and Turkey (McTavish et al 2012), and milk fats have been found in Turkey near the Sea of Marmara from the same period. By around 5,000 BC, domestic cattle had appeared along the southern coast of the North Sea.
Drinking milk requires a genetic constitution for lactose tolerance. In fact, most people on the planet are lactose intolerant. When the genetic mutation for tolerance emerged, these individuals gained a clear advantage: the possession of small moveable dairy factories supplying them with proteins, fats, vitamines, carbohydrates, and minerals. This mutation appears roughly at the same time as nomadic pastoralism—the practice of moving with your cattle and sheep in search of fresh pastures (Pront & McMarron 2023).
Farming communities entered Europe from the east along two main routes: the Central European route through Hungary and Germany, and the southern Mediterranean route via Turkey and Greece. The Neolithic Age lasted roughly from 5,000 to 2,000 BC, when it was succeeded by the Bronze Age.
The first farmers and cattle herders from southwest Asia entered Europe via the Mediterranean route, using western Anatolia in Turkey as a stepping stone. Between roughly 7,000 and 6,500 BC, the first farming communities established themselves in western Anatolia, northern Greece, the Peloponnesus, and on the island of Crete. By around 6,000 BC, they had reached southern Italy, from where they migrated into Mediterranean France and Spain.
Genetic research has shown that agriculture was not merely the spread of an idea, but the movement of people carrying this knowledge. This migration is generally associated with the spread of the Indo-European language family, with western Anatolia considered its homeland. This southern Mediterranean route, with slightly varying timelines, is confirmed by several genetic studies (Myres 2011, Bouckaert 2012, Hofmanová 2016).
The second, later wave of farmers traveled along the Central European route, moving from Hungary through Germany to France, around 5,500 BC. This group reached the British Isles and Scandinavia between roughly 4,000 and 3,000 BC. These genetic movements correspond closely with archaeological evidence of the spread of the Linearbandkeramik (LBK) culture, also known as Linear Band Ware, which followed the major rivers Danube, Elbe, and Rhine across Europe.
So, beginning around 7,000 BC, the transition of Europe from hunter-gatherers to farmers started in the southeast and was largely complete by roughly 3,000 BC, when it had reached the western edges of the continent (Gkiasta 2003). These new settlers were genetically distinct from the existing population and closely related to groups in the Near East (Bramanti 2009, Balaresque 2010). Not much mercy was shown to the hunter-gatherers.
Haplogroup R-M269 coincides with the arrival and spread of agriculture across the European continent. It is also linked to the spread of Indo-European languages. Today, more than 100 million European men carry Y chromosomes belonging to R-M269. Furthermore, haplogroup R-M412—also known as S167 or L51—can be considered the founder of western Europe. More than seventy percent of all western European men carry this mutation. Its frequency is highest in the west and gradually decreases eastward, while it is absent in the Near East, the Caucasus, and West Asia (Myres 2011).
The immigration waves of R-M269 peoples did not entirely wipe out the native European hunter-gatherers. Au contraire, research has revealed a complex process of admixture. A study of the human remains known as Kostenki 14, dated to 34,000 BC and found in Russia, shows that much of its genetic makeup (C-M130) can still be traced in western Europeans, with the strongest resemblance in northern Europe, especially the Baltics. This research also demonstrates that European hunter-gatherers had already split from the East Asian gene pool by around 34,000 BC.
The K14 DNA also contains a relatively high proportion of Neanderthal ancestry—2.4 percent (Seguin-Orlando 2014). Unsurprisingly, features of northern Europeans still reflect this admixture ;-) Other studies confirm that Bronze Age populations in central and northern Europe were composed of a mix of incoming Neolithic farmers and native Mesolithic hunter-gatherers (Allentoft 2015).
AGCAACAGGAATGAAACTCCAATGAAAGAAAGAAAAGGAAG/GAAA/GAAAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GGAGGGTGGGCGTGGTG
This is the R-S21 DNA sequence—not someone choking
In 2005, R-S21 was identified for the first time by Dr. Faux of the company EthnoAncestry, Ltd. This haplogroup became one of the distinctive genetic groups in north-western Europe. The R-S21 has different names, by the way. First known as R1b1b2a, and later as R1b1b2a1a. It is also known as R-U106 and R-M405. Out of all these names, we use R-S21, without having a particular criterion to choose this name other than that it is a relatively short and practical notation.
The European haplogroup R-269 can be subdivided into the north-western haplogroup R-S21, the western haplogroup R-S145, also known as R-L21, and the southern haplogroup R-S28, also known as R-U152. R-S21 frequencies score highest in the Netherlands with almost eighty percent and fade out to the east and south, with respectively over fifty percent in the Czech Republic and only about twenty-five percent left in Italy. Hence, R-S21 is considered the ‘north-western’ or ‘Germanic’ haplogroup (Lucotte 2015). That R-S21 frequencies are highest in the Netherlands was established already before, soon after its discovery in 2005 (Myres 2007). More specifically, this means that the Netherlands is the most obvious location for the common ancestor of the Germanic peoples. Moreover, other genetic research showed that within the Netherlands, the province of Friesland had the highest frequencies of R-S21 (Busby 2011). That is way the term 'Frisian branch' is used form time to time.
Quite recent research (Altena 2019) investigated the most common yDNA haplogroups within the Netherlands, namely haplogroup I (twenty-eight percent) and R (sixty-two percent). Within R, the most common haplogroups are R-L48 (fifteen percent), R-S21 (fourteen percent), and R-S116 (nine percent). This research showed highest frequencies of R-S21 along the coastal zone, but this time with the province of Zeeland being the highest. However, all gradient differences were marginal. When the genetic dataset of the region of Flanders in Belgium was combined with that of the Netherlands, no significant gradient concerning R-S21 was observed anymore. Thus, this study of Altena does not present a deeper insight into the local spread of the ‘Germanic’ chromosome R-S21 within the Netherlands, additional to the studies mentioned of Lucotte and Busby. Within the wider region including Germany, however, the results of Altena do confirm the southeast-northwest axis of haplogroup R-S21, with increasing frequencies towards the northwest, i.e., towards the Netherlands.

Furthermore, in general, male yDNA shows clear genetic geographic patterns in the Netherlands, whilst female mtDNA does not show any population substructures (Chaitanya 2015). This could mean different demographic patterns between men and women, yet to be explained.
We could not find firm results on dating the age of R-S21, but it spread over north-western Europe during the Neolithic Age (New Stone Age), between circa 5,000 and 2,000 BC (Lucotte 2015). So, it spread from the shores of the Netherlands to southern Scandinavia, Belgium, northern France, and into Germany. Others date R1b-S21 between 3,400 and 2,500 BC (McNeill), or around 3,000 BC (FamilyTreeDNA), or between 2,600 and 500 BC (McDonald 2015). To what extent the three latter datings are, in fact, repetitive memes, we do not dare to say. No scientific substantiation could be found on these, anyhow.
Being an R-S21 mutant
Maybe after reading this blog post you will be tempted to send off your DNA to one of those family tree companies, just to find out whether you are 'truly' Germanic. But then the real question arises: what does it actually mean? Should we start chasing rabbits now? Will this knowledge change your life in any meaningful way?
The answer: not at all. So, do not start chasing rabbits.
It simply means that you share a common ancestor with all the other people carrying this tiny piece of DNA. You are part of the peoples of north-western Europe—the so-called Germanic countries. This common ancestor was born, perhaps 5,000 years ago, in the area that is now the Netherlands. He lived in a landscape shaped by the confluence of major rivers, with extensive marshlands and peat bogs, bordering the sea. Most likely, he dwelled near the coast, very possibly in what is now the province of Friesland.
From there, his descendants spread across the Germanic regions of today, particularly to the east of the River Rhine and into southern Scandinavia. These tribes were first called Germanic by the Romans around two thousand years ago—a generic label, applied without much anthropological or genetic justification. Likewise, some of these peoples have also been called Celts.
For more on the question of Germanic or Celtic identity, check out our blog post Barbarians riding to the Capital to claim rights on farmland.
Later, during Late Antiquity and the Early Middle Ages, migration movements occurred from southern Scandinavia back to the south and southwest again, and from the southern coast of the North Sea into Britain. The latter explains why, in fact, modern English and Frisians are genetically indistinguishable (Weale 2002). Check also our blog post Have a Frisians Cocktail! A rich composition to learn more about the Anglo-Saxon-Frisian connection. During the late Early Middle Ages, another wave of Germanic immigrants to the British Isles occurred. These were called Norsemen or Northmen. Their genetic footprint is that about six percent of the UK population carries "Viking DNA" (Margaryan 2020).
Furthermore, the migrating offspring of the so-called ‘Frisian godfather mutant’, of course, admixed with other genetic, ‘original’ populations.
In other words, the DNA of what we call the Germanic peoples is much richer than R-S21 and very complicated. Moreover, we do not even know if this particular Germanic haplogroup is responsible for any features. If you think it might be a white complexion, eh’nt! Wrong. Probably, the early farmers migrating from the Near East already had this phenotype already. To finish it off; blue eyes were already present among the hunter-gatherers in Europe, long before the R-S21 mutant came into play (Lalueza-Fox 2012, Allentoft 2015).
Look at Fred Flintstone, his family and his neighbours, and judge for yourself how accurate their image is.

We arrived at the end of the Rabbit Hole.
Conclusion, we (re)confirmed the location of the so-called Frisian godfather of the 'Germanic' gene pool. It is, as stated, exactly where most of the Frisia Coast Trail runs today!
What we find most fascinating is that genetic research has—at least for now—shown that the Proto-Germanic peoples originated along the southern coast of the North Sea and spread from there into Europe. So, at long last, the Frisians have something to boast about. Together with their inseparable sheep, they can bleat that they are the true forefathers of Vikings, Saxons, Franks, and Anglo-Saxon warriors.
But before they burst out singing and shouting “Who’s your daddy?”, it is worth asking: what does this particular piece of DNA really mean for how we look, or how we (mis)behave(d)? The answer: nothing at all. It does not mean squat. At least nothing concrete, as far as we could discover. Yes—another bubble popped.
We hope that is not too much of a disappointment for you that we end this blog post like this. It is like what Socrates said: “Ένα ξέρω, ότι δεν ξέρω" (I know that I know nothing). Who knows what more knowledge genetic research will bring in the near future. A lot we expect!
...|
Note 1 — In our blog post The Giants of Twilight Land. Creatures of the Rim we described the happy, long lugs of the north of the Netherlands. In fact, the tallest people that have ever lived on the earth. Has it to do with their genes?
Note 2 — A sick idea to create more Lebensraum for Germanic genes.
During the Second World War, the Nazis carried out a sick scheme in Europe. In the Netherlands it was first called Culano (Commission for Sending Farmers to Eastern Europe), but later it was taken over by the NSB (National-Socialist Movement) itself under the very original banner of the NOC (Dutch East Company). The reuse of a name once tied to Dutch overseas trade for this shabby colonial fantasy only underlined the delusions at play.
Soon after Hitler had conquered Eastern Europe, the Nazis tried to mobilize people from the so-called Germanic countries to colonize these new lands, especially the Baltics, Belarus, and Ukraine. It was meant as a way to replace the Slavic population with a Germanic one, creating more Lebensraum—a continuation of the Drang nach Osten and the ideology of Umvolkung. In most European countries there were no volunteers, but in the Netherlands, there were surprisingly many. According to Heinrich Himmler, the Dutch were “blutmässig unerhört wertvolle Kräfte”—racially of exceptional value.
From 1941 onward, the first Dutch volunteers left for the East. Frisians featured prominently in this scheme, both in organizing and in volunteering. The Frisian Director General of Agriculture, Geert Ruiter—an SS member—was one of the driving forces within the Dutch government. Although the farming sector in the Netherlands was already in decline, most volunteers explained their participation by pointing to their NSB membership.
The whole scheme was an utter disaster, as was everything that came out of Nazi brains. The Nazis grew frustrated that the Dutch pioneers soon mingled with the Slavic population, including engaging in sexual relationships with local non-Germanic women. Moreover, many Dutch farmers turned into smugglers and fences. From 1944 onward, these so-called blutmässig wertvolle Kräfte rushed back to the Netherlands—and to Friesland in particular—once the Red Army counterattacked all the way to Berlin.
Note 3 — In the region associated with the Frisian branch of the R-S21 haplogroup, the world’s oldest known boat has also been discovered: the Pesse Canoe. Its age has been dated between 8040 and 7510 BC, meaning it possibly even predates the earliest known Germanic ancestor. For more, read our blog post Oldest Vessel of the World—the Pesse Canoe.
Suggested music
Jefferson Airplane, White Rabbit (1967)
Lamont Dozier, Going To My Roots (1977)
Kid Creole and the Coconuts, Who's Your Daddy Now? (2001)
Further reading
Allentoft, M.E. et al, Population genomics of Bronze Age Eurasia (2015)
Altena, E. et al, The Dutch Y-chromosomal landscape (2019)
Balaresque, P. et al, A Predominantly Neolithic Origin for European Paternal Lineages (2010)
Balter, M., How Farming Reshaped Our Genomes (2014)
Bouckaert, R. et al, Mapping the origins and expansion of the Indo-European language family (2012)
Bramanti B. et al, Genetic discontinuity between local hunter-gatherers and Central Europe’s first farmers (2009)
Busby, G.B.J. et al, The peopling of Europe and the cautionary tale of Y chromosome lineage R-M269 (2011)
Byrne, R.P. et al, Dutch population structure across space, time and GWAS design (2020)
Chaitanya, L. et al, High-quality mtDNA control region sequences from 680 individuals sampled across the Netherlands to establish a national forensic mtDNA reference database (2015)
Connor, S.A., Revealed: First Ol’ Blue Eyes is 7,000 years old and was a caveman living in Spain (2014)
Davis, R.C., Christian Slaves, Muslim Masters. White slavery in the Mediterranean, the Barbary Coast, and Italy, 1500-1800 (2003)
Dawkins, R. The Selfish Gene (1976)
Dockyards, the., Genetic Maps of Europe, website (2020)
Eupedia.com, European Prehistory, Anthropology & Genetics (website)
Eupedia.com, New map of R1b-S21 (U106) (2011)
Frijtag Drabbe Künzel, von G., Het Oosten roept (2020)
Frijtag Drabbe Künzel, von G., Hitler's Brudervolk. The Dutch and the Colonization of Occupied Eastern Europe, 1939-1945 (2015)
Gkiasta, M. et al, Neolithic transition in Europe: the radiocarbon record revisited (2003)
Hofmanová, Z. et al, Early farmers from across Europe directly descended from Neolithic Aegeans (2016)
Jacobson, R., New Evidence Fuels Debate over the Origin of Modern Languages. Nomadic horse riders likely opened a “steppe bridge” between Europe and Asia, but recent genetic data raise more questions (2018)
Lucotte, G. et al, The Major Y-Chromosome Haplogroup R1b-M269 in West-Europe, Subdivided by the Three SNPs S21/U106, S145/L21 and S28/U152, Shows a Clear Pattern of Geographic Differentiation (2015)
Margaryan, A, et al, Population genomics of the Viking world (2020)
McDonald, I., U106 explored: its relationships, geography and history (2015)
McNeill, J., McNeill and Beyond — A Memoir (website)
McTavish, E.J., Decker, J.E., Schnabel, R.D. & Hillis, D.M., New World cattle show ancestry from multiple independent domestication events (2013)
Micheletti, S.J. et al, Genetic Consequences of the Transatlantic Slave Trade in the Americas (2020)
Myres, N.M. et al, A major Y-chromosome haplogroup R1b Holocene era founder effect in Central and Western Europe (2011)
Myres, N.M. et al, Y-chromosome Short Tandem Repeat DYS458.2 Non-consensus Alleles Occur Independently in Both Binary Haplogroups J1-M267 and R1b3-M405 (2007)
O’Sullivan, K., DNA study reveals fate of Irish women taken by Vikings as slaves to Iceland. Ancient Iceland settlers had even split of Norse and Gaelic ancestry (2018)
Pront, M. & McMarron, M., Waarom zijn we ooit koemelk gaan drinken? (2023)
Reich, D., Who we are and how we got here. Ancient DNA and the New Science of the Human Past (2018)
Seguin-Orlando, A. et al, Genomic structure in Europeans dating back at least 36,200 years (2014)
Shaw, J., Who Killed the Men of England? (2009)
Sijens, D., Friese bewegers: Geert Ruiter. Pleiter foar boerebelangen yn it ferkearde tiidrek (2016)
Thomas, M. G., Stumpf, M. P. & Harke, H., Evidence for an apartheid-like social structure in early Anglo-Saxon England (2006)
Weale, M.E. et al, Y Chromosome Evidence for Anglo-Saxon Mass Migration (2002)
Wilson, J.F., Weiss, D.A., Richards, M., Thomas, M.G., Bradman, N. & Goldstein, D.B., Genetic evidence for different male and female roles during cultural transitions in the British Isles (2001)
Zerjal, T. et al, Geographical, Linguistic, and Cultural Influences on Genetic Diversity: Y-Chromosomal Distribution in Northern European Populations (2001)

