R1b/Hg1/Eu18; R-M213; R-M9; R1b-M45; R-M207; R-M173; R-M343; R-L278; R-L754; R-L389/R1b1a1; R-M415; R-P297/R1b1a1a; R-M269/R1b1a1a2; R-M520; R-L23; R-M412; R-L11; R-S21/U106/M405/R1b1a1a1a2a1a1... Knock Knock… Wake up Neo… Follow the White Rabbit…|
These serial numbers, chronologically arranged, represent groups and subgroups of people who genetically share one common ancestor. Pulling these protein strands is like going down the Rabbit Hole. It leads you from the Old Stone Age, to the Middle Bronze Age. From 20,000-15,000 years ago, to 4,500-4,000 years ago. From the shores of the brackish Caspian Sea to the southern shores of the murky North Sea. It's at these muddy cold waters where the genetic common ancestor of the Germanic peoples once lived. The highest concentration of this specific DNA today, can be found precisely in the area which the Frisia Coast Trail covers. Some even speak of the ‘Frisian branch‘.
So, the irrelevant question arises:
Is Frisia the cradle of the Germanic peoples?
This post is about genetics. Developments in this research field go in a high pace. Nearly impossible to keep track with. We, therefore, repeat a warning we found on the web concerning genetics: “Everything presented in this document is wrong. The question is: how wrong?” (MacDonald 2015).
Trying to understand the language geneticists use, is like decoding The Matrix. Therefore, people easily risk copying existing texts on the web. We recall Dawkins (1976) that this is exactly how memes behave. An idea or a (cultural) concept replicating itself through the minds of people. Like the present one, which says that the G5 network is responsible for COVID-19. Before you know it, everybody starts believing it. Identical to how our selfish genes operate. In today’s language of policy makers and news reporters, memeing is called framing. Yeah, you got the idea by now.
Immediate cause for us to take a closer look at the 'Frisian branch’, was the recent post ‘Genetic Maps of Europe’ of blog The Dockyards this summer (2020). That post, however, turned out to be a replication (indeed, a meme) of the information available on the community platform Eupedia, which has a separate section on the genetics of Europe. Sadly, no useful specific references at Eupedia either, albeit their visual presentation is quite impressive. You're almost convinced without reading a single syllable. So, we descended further down the Hole. In search of sources this so-called Frisian branch theory is based upon. Browsing for ‘Germanic DNA‘ we found mostly more or less replicating texts saying this genetic group was (proto-) Germanic, that it originates from the shores of the Netherlands and of northwest Germany, and that's about 2.500 years old. Indeed, a meme or frame. But what's the veracity? Or better, what's least wrong?
We continued following the White Rabbit. Trying to leave the countless web parrots behind us, and with great awe and reverence we, humble coastal hikers, explored articles of genetic science. Below is what we found. When, however, you're the type who prefers to remain in blissful ignorance, this is the moment to stop reading this post and swallow the blue pill. Actually, often the better choice in life.
Welcome in Wonderland
Our condolences, you continued reading.
Before we start, we must explain two or three things about genetics. Don't worry, we limited it to the bare minimum, to avoid reading this post feels like a lecture, and because of our extreme limited understanding of this complex science as well.
YX and XX
DNA research concerning the origin of men can be approached via the male chromosomes or via the female chromosomes. The first is the study of the Y chromosome (yDNA). This is DNA passed on from father to son via the Y chromosome. The second is the mitochondrial DNA (mtDNA), which is passed from mother to her children via the two X chromosomes. There's a third variant, namely autosomal DNA (atDNA), which studies the twenty-two non-sex related chromosomes. We leave atDNA for what it is. Most genetic research focusing on origins of peoples concentrates on the Y chromosome, because it's especially useful for reconstructing population histories (Altena 2019).
Comparing yDNA and mtDNA can give you interesting insights in the (mis-)behavior of males. For example, the yDNA of African Americans in the United States is overall thirty-three percent European. When you look at the mtDNA of the same African Americans, only about six percent is European. A Snow White-like mirror, this time genetically confronting us with the behavior of European men during slavery (Shaw 2009).
Comparable male behavior might have taken place during the colonization of England by the so-called Anglo-Saxons, considering the massive contribution to the English gene pool. Indeed, early Anglo-Saxon society might have known apartheid-like structures in which the native Romano-Celtic population was restricted in reproduction (Thomas 2006).
Another example concerns the population of modern Iceland. Male yDNA is predominantly Nordic and female mtDNA is predominantly Gaelic (O’Sullivan 2018). The Icelandic sagas recount of women from Ireland and Scotland raided by Vikings, are thus genetically confirmed. Unless Irish and Scottish women were attracted by the beauty of the Icelandic landscape and travelled voluntarily to the island, and took the uncivilized Vikings for granted. Similar to Iceland, is the DNA of Scandinavian men and Celtic women on the Faroe (Gershon 2021). Read also our post Latið meg ei á Frísaland fordervast! to read more about this grab-a-woman phenomenon, only this time done by Frisian pirates operating in the northern seas.
In the period 1530 and 1780 about one million and a quarter European Christians were enslaved by Muslims of northern Africa, the so-called Barbary Coast. We're not aware much research has been done into the DNA footprint of these European slaves in northern Africa, but possibly less visible than the examples of the African Americans and Anglo-Saxons, because Muslims prevented Christian male slaves to reproduce themselves. Vigorously even. To what extent female white slaves bare children with Muslim offspring, is unknown. However, around the year 1700 citizens of the city of Algiers were known for their white complexion (Davis 2003).
Yes, once you're down the Rabbit Hole, there's little Miss Sunshine left. Sorry to have popped the bubble.
Haplogroups
A central entity you come across in genetics are haplogroups, sub-haplogroups and haplotypes. A haplogroup is a group of haplotypes. Haplotypes are organisms, including humans, that share a common ancestor with a specific, chromosomal mutation. Subgroups of a haplogroup are often named clades, subclades or, even more brainy, single nucleotide polymorphisms (SNPs, pronounced as snips). The term ‘genetic marker’ or short ‘marker’ is thrown in for good measures as well. Since all these genetic (sub)groups are one way or the other a sub set of an older DNA lineage, or at least constitute a common genetic variation, we keep it simple and stick to the term haplogroup in this post. Probably missing all kinds of crucial subtleties, but it does give you a feeling you understand some things.
Another difficulty we experienced, is the inconsistent naming of haplogroups. You might have three, four, sometimes five different names for a single haplogroup. Besides that, the names itself are always a confusing combination of letters and numbers. Cause of this wild growth of names is commerce. Private companies are very active in the genetic genealogy business and have their own naming. Science is, predictably and vainly, reluctant to copy names invented by the ruffians of the firms of the private sector. Nothing good can come from commerce, of course.
Try not to resist it. It's too late for the blue pill anyway.
Sign the Times
A last remark concerns the use of time scales and the determination of the age of haplogroups. Geneticists, like geologists, often use the abbreviation BP (before present) rather than BC (before Christ) and AD (Anno Domini) as most archaeologists and historians do, or rather than BCE (before the common era) and CE (common era), which is used by scholars who want to stay religiously and politically inclusive. The BP time scale takes the year 1950 as ‘Present’. As to why? It has something to do with radiocarbon dating. Don't bother. Plus, you've scholars who use the abbreviation ya (years ago) with k as thousand, m as million and b for billion. So, 9kya is 9,000 years ago. Lastly, you've those simple souls of science who only use, for example, ‘9,000 years ago’. Check the date the article was published in for example science journal Nature, and you know the age of the haplogroup. Or, should you take the date when the research was carried out a few years before?
Anyway, it resembles a situation comparable to the many different electric plugs, connectors, and sockets in the world, without anyone having an adapter. We decided to stick with BC and AD. Familiar to everyone.
Concerning the dating of Y-chromosome lineages, based on mutation rates, this in general is notoriously difficult and thus controversial within science. Age estimates can differ by a factor of three (Busby 2011). Again, the question is: how wrong?
Genetic Europe
Where in the history of genes should we start our post? At the cradle of mankind in Africa, with Lucy? Or maybe a bit further down the road?
We opted to start where the genetic tree splits and haplogroup Rb1 emerged. Fifty percent of men in Europe, namely, carries the genetic combination of the R haplogroup. It emerged in West Asia based on three evident genetic splits which occurred outside Europe. Probably between 23,500 and 10,500 BC. Not a very precise estimation, indeed. The two main branches of R1b are: the R-V88, a group migrating to Central Africa, and the R-M269, a group migrating to Europe.
AGCAACAGGAATGAAACTCCAATGAAAGAAAGAAAAGGAAG/GAAA/GAAA/GAAA/GAAA/GAAAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GGAGGGTGGGCGTGGTG
This is the R-M269 DNA sequence, not somebody in agony.
During the Mesolithic Age, also called the Middle Stone Age, between around 9,000 to 5,000 BC (interestingly enough, there isn't a real consistent time period for -also- the Mesolithic), people living in Europe were hunter-gatherers who had started to settle and who built huts. Before that, during the Paleolithic Age or Old Stone Age, people basically wandered around in small units, and sought shelter in caves. Farming was still unknown for these captains caveman, during the Mesolithic Age.
Around 8,000 BC, agriculture techniques, including cattle herding, developed in the Fertile Crescent in southwest Asia, i.e. the combined regions of Assyria, Mesopotamia, the Nile Delta and Phoenicia. These farmers also started to migrate and took with them their new technology. Around 5,500 BC, they spread into Europe and initiated a dramatic growth of the European population (Busby 2011). It marked the end of the Mesolithic Age and the beginning of the Neolithic Age, also called the New Stone Age. Indeed, "Wake up Neo..." and Bedrock-cities started to pop up like mushrooms.
Farmer communities entered Europe from the east via two main routes: the central European route via Hungary and Germany, and the southern, Mediterranean route via Turkey and Greece. The Neolithic Age lasted from around 5,000 to 2,000 BC when the Bronze Age started.
The first farmers and cattle herders from southwest Asia, reached Europe via the Mediterranean route with western Anatolia in Turkey as steppingstone. It was between circa 7,000 and 6,500 BC that the first farmers based themselves in western Anatolia, northern Greece, on the Peloponnesus, and on island Crete. By around 6,000 BC, they had reached the south of Italy. From there they migrated to Mediterranean France and Spain. Genetic research also proved that agriculture wasn't the migration of a concept, but the migration of people carrying this knowledge. This migration flow is generally identified with the spread of Indo-European language family, and western Anatolia is considered its homeland. This southern, Mediterranean route, with only slightly different time scales, is confirmed in different genetic research (Myres 2011, Bouckaert 2012, Hofmanová 2016).
The second, younger flow of farmers came along the central European route, via Hungary through Germany to France, and took place around 5,500 BC. This group reached the British Isles and Scandinavia around 4,000 to 3,000 BC. These genetic movements resemble the archaeological findings on how the Linearbandkeramik (LBK) culture, also called Linear Band Ware, spread over Europe. Following the rivers Danube, Elbe and Rhine.
So, from roughly 7,000 BC the transition of Europe from hunter-gatherers to farmers started in the southeast of Europe and was accomplished by around 3,000 BC, when it had reached the western fringes of the Continent (Gkiasta 2003). These new settlers were genetically distinct from the existing population, and were related to populations in the Near East (Bramanti 2009, Balaresque 2010).
It's haplogroup R-M269 that coincides with the arrival and spread of agriculture over the European Continent. Also, R-M269 is associated with the spread of the Indo-European languages. Today, more than 100 million European men carry Y chromosomes belonging to R-M269. Furthermore, haplogroup R-M412, also named S167 or L51, can be considered the founder of western Europe. More than seventy percent of all West-European men carry this mutation. The frequencies of R-M412 are highest in the west and decreasing eastward, while it's absent in the Near East, Caucasus, and West Asia (Myres 2011).
The immigration flows of the R-M269 peoples didn't wipe out the native European hunter-gatherers (entirely). Au contraire, research revealed a complex process of admixture. Study of the human remains of the so-called Kostenki 14 body (dated 34,000 BC found in Russia), shows that much of its genes (C-M130) can still be traced in western Europeans, with highest resemblance in northern Europe, especially the Baltics. This research also demonstrates that the European hunter-gatherers split from the East Asian gene pool around 34,000 BC already. The K14 DNA also contains relatively high Neanderthal ancestry, namely 2,4 percent (Seguin-Orlando, 2014). Of course, features of northern Europeans still show their admixture. Other research also confirmed that Bronze Age populations in central and northern Europe are composed of an admixture of new Neolithic farmers and native, Mesolithic hunter-gatherers (Allentoft 2015).
AGCAACAGGAATGAAACTCCAATGAAAGAAAGAAAAGGAAG/GAAA/GAAAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GAAA/GGAGGGTGGGCGTGGTG
This is the R-S21 DNA sequence, not someone choking. For your convenience we have marked in bold the difference with the R-M269 sequence.
In 2005, R-S21 was identified for the first time by dr. Faux of the company EthnoAncestry, ltd. This haplogroup became one of the distinctive genetic groups in northwestern Europe. The R-S21 has different names, by the way. First known as R1b1b2a, and later as R1b1b2a1a. It's also known as R-U106 and as R-M405. Out of all these names we use R-S21, without having a particular criteria to choose this name other than it's a relatively practical short notation.
The European haplogroup R-269 can be subdivided into the northwestern haplogroup R-S21, the western haplogroup R-S145 (also known as R-L21), and the southern haplogroup R-S28 (also known as R-U152). R-S21 frequencies score highest in the Netherlands with almost eighty percent, and fade out to the east and south, with respectively over fifty percent in the Czech Republic, and about twenty-five percent in Italy. Hence, R-S21 is considered being the ‘northwestern’ or ‘Germanic’ haplogroup (Lucotte 2015). That R-S21 frequencies are highest in the Netherlands was established already before, soon after its discovery in 2005 (Myres 2007). More specific, this means that modern the Netherlands is the most obvious location for the common ancestor of the Germanic peoples. Moreover, other genetic research showed that within in the Netherlands, province Friesland had highest frequencies of R-S21 (Busby 2011).
Quite recent research (Altena 2019) investigated the most common yDNA haplogroups in the Netherlands, namely haplogroup I (twenty-eight percent) and R (sixty-two percent). Within R, the most common haplogroups are R-L48 (fifteen percent), R-S21 (fourteen percent), and R-S116 (nine percent). This research showed highest frequencies of R-S21 along the coastal zone, but this time time with province Zeeland highest. But all gradient, differences were marginally. However, when the genetic dataset of Flanders in Belgium was combined with that of the Netherlands, no significant gradient concerning R-S21 was observed anymore. So, this study of Altena doesn't present a deeper insight into the local spread of the ‘Germanic’ chromosome R-S21 within the Netherlands additionally to the studies mentioned of Lucotte and Busby. Within the wider region with Germany, however, the results of Altena do confirm the southeast-northwest axis of haplogroup R-S21, with increasing frequencies towards the northwest, i.e. towards the Netherlands.
Furthermore, in general, male yDNA shows clear genetic geographic patterns in the Netherlands, whilst female mtDNA doesn't show any population substructures (Chaitanya 2015). This could mean different demographic patterns between men and women, yet to be explained.
We couldn't find firm results on dating the age of R-S21, but it spread over northwestern Europe during the Neolithic Age (New Stone Age), between circa 5,000 and 2,000 BC (Lucotte 2015). So, spreading from the shores of the Netherlands to southern Scandinavia, Belgium, northern France and into Germany. Others date R1b-S21 between 3400-2500 BC (McNeill), or around 3,000 BC (FamilyTreeDNA), or between 2,600 and 500 BC (McDonald 2015). To what extent the three latter datings are, in fact, repetitive memes, we do not dare to say. No scientific substantiation could be found on these, anyhow.
Being an R-S21 mutant
Maybe after reading this post you decide to test your own DNA at one of those family tree companies to see if you're 'true' Germanic. But you may ask yourself, what does it mean? Should we start chasing rabbits? How will this knowledge change my life?
The answer: not at all. It solely means you have a common ancestor together with all other people sharing this tiny piece of DNA strand. Being part of the peoples who live in northwestern Europe, the Germanic countries. This common ancestor was born, perhaps 5,000 years ago, in the area what's now the Netherlands. In a habitat that was a confluence of big rivers bordering the sea. Most probably this ancestor lived near the coast, and very well in what's now province Friesland. From there, his offspring spread over the Germanic countries of today. Particularly, further to east of the river Rhine and to southern Scandinavian. These tribes were first called Germanic first by the Romans, two thousand years ago. A generic classification given by them the Romans without too much anthropological or genetic substantiation. Just as well these people have been named Celts.
Later, during the Late Antiquity and the Early Middle Ages, migration movements happened from southern Scandinavia back to the south and southwest again, and from the southern coast of the North Sea into Britain. The latter explaining why, in fact, the modern English and Frisians are genetically indistinguishable (Weale 2002). Check also our post Have a Frisians Cocktail to learn more about the Anglo-Saxon-Frisian connection. During the late Early Middle Ages, another wave of Germanic immigrants to the British Isles occurred. These were called Norsemen. Their genetic footprint is about six per cent of the UK population carries 'Viking DNA' (Margaryan 2020).
Furthermore, the migrating offspring of the so-called ‘Frisian godfather mutant’, of course, admixed with other genetic, ‘original’ populations. In other words, the DNA of what we call the Germanic peoples is much richer than R-S21 and very complicated. Above, we don't even know if this particular Germanic haplogroup is responsible for any features. If you think it might be a white complexion, eh’nt! Wrong. Probably, the early farmers migrating from the Near East already had this phenotype already. To finish it off; blue eyes were already present among the hunter-gatherers in Europe long before the R-S21 mutant came into play (Lalueza-Fox 2012, Allentoft 2015).
Look at Fred Flintstone, his family and his neighbours, and judge for yourself how accurate their image is.
We arrived at the end of the Rabbit Hole.
Conclusion, we (re-)confirmed the location of the so-called Frisian godfather of the 'Germanic' gene pool. It's exactly where most of the Frisia Coast Trail runs today.
What we think is the most interesting part, is that genetic research proved -for the time being- that proto-Germanic peoples originate on the southern coast of the North Sea and spread from there into Europe. Thus, from now on Frisians finally have something to boast of about, and can bleat like their inseparable sheep they're the real daddies of Viking, Saxon, Frankish, and Anglo-Saxon warriors. But before they go off singing and shouting "Who's your daddy?", what does this specific piece of DNA mean in terms of how we look like and how we (mis)behave(d), et cetera? Well, it doesn't mean squat. At least, nothing concrete, as far as we could find. Yes, another bubble popped. We hope that's not too much of a disappointment for you that we end this post like this. It's like what Socrates said: “Ένα ξέρω, ότι δεν ξέρω" (I know that I know nothing). Who knows what more knowledge genetic research will bring in the near future. A lot we expect!
...|
Annex:
More Lebesraum for Germanic genes
During the Second World War, the Nazis carried out a sick scheme in Europe. In the Netherlands it was named, at first, Culano (i.e. Commission for Sending Farmers to Eastern Europe) but later carried out by the NSB (i.e. National-Socialist Movement) itself under the very original banner of the NOC (i.e. Dutch East Company).
Soon after Hitler had conquered eastern Europe, the Nazis tried to mobilize people from the Germanic countries to colonize these new lands, especially the Baltics, Belarus and Ukraine. A way to replace the Slavic race by the Germanic one, and creating more Lebesraum. The "Drang nach Osten". In most European countries there were no volunteers but in the Netherlands, however, there were quite a few. The Dutch were “blutmässig unerhört wertvolle Kräfte” according to Heinrich Himmler.
From 1941 the first Dutch volunteers left for the east. Frisians featured prominently in this scheme, both in organizing as in volunteering. The Frisian Director General of Agriculture Geert Ruiter, and member of the SS, was one of the driving forces of the Dutch government. Although the farming sector in the Netherlands was in decline, most volunteers gave as reason their membership of the NSB.
The whole scheme was an utter disaster, as was everything that came out of the brains of the Nazis. The Nazis showed their frustration that the Dutch pioneers soon mingled with the Slavic people, including having sexual affairs with the local non-Germanic women. Furthermore, many Dutch farmers transformed into smugglers and fences. From 1944 onward, the so-called blutmässig wertvolle Kräfte hastily returned, with their scared genes, to the Netherlands and province Friesland once Russia was in the counter attack all the way to Berlin.
Note – In our post The Giants of Twilight Land we described the happy, long lugs of the north of the Netherlands. In fact, the tallest people that have ever lived on the earth. Has it to do with their genes?
Suggested music
Jefferson Airplane, White Rabbit (1967)
Lamont Dozier, Going To My Roots (1977)
Kid Creole and the Coconuts, Who's Your Daddy Now? (2001)
Further reading
Allentoft, M.E. et al, Population genomics of Bronze Age Eurasia (2015)
Altena, E. et al, The Dutch Y-chromosomal landscape (2019)
Balaresque, P. et al, A Predominantly Neolithic Origin for European Paternal Lineages (2010)
Balter, M., How Farming Reshaped Our Genomes (2014)
Bouckaert, R. et al, Mapping the origins and expansion of the Indo-European language family (2012)
Bramanti B. et al, Genetic discontinuity between local hunter-gatherers and Central Europe’s first farmers (2009)
Busby, G.B.J. et al, The peopling of Europe and the cautionary tale of Y chromosome lineage R-M269 (2011)
Byrne, R.P. et al, Dutch population structure across space, time and GWAS design (2020)
Chaitanya, L. et al, High-quality mtDNA control region sequences from 680 individuals sampled across the Netherlands to establish a national forensic mtDNA reference database (2015)
Connor, S.A., Revealed: First Ol’ Blue Eyes is 7,000 years old and was a caveman living in Spain (2014)
Davis, R.C., Christian Slaves, Muslim Masters. White slavery in the Mediterranean, the Barbary Coast, and Italy, 1500-1800 (2003)
Dawkins, R. The Selfish Gene (1976)
Dockyards, the., Genetic Maps of Europe, website (2020)
Eupedia, European Prehistory, Anthropology & Genetics (website)
Frijtag Drabbe Künzel, von G., Het Oosten roept (2020)
Frijtag Drabbe Künzel, von G., Hitler's Brudervolk. The Dutch and the Colonization of Occupied Eastern Europe, 1939-1945 (2015)
Gkiasta, M. et al, Neolithic transition in Europe: the radiocarbon record revisited (2003)
Hofmanová, Z. et al, Early farmers from across Europe directly descended from Neolithic Aegeans (2016)
Jacobson, R., New Evidence Fuels Debate over the Origin of Modern Languages. Nomadic horse riders likely opened a “steppe bridge” between Europe and Asia, but recent genetic data raise more questions (2018)
Lucotte, G. et al, The Major Y-Chromosome Haplogroup R1b-M269 in West-Europe, Subdivided by the Three SNPs S21/U106, S145/L21 and S28/U152, Shows a Clear Pattern of Geographic Differentiation (2015)
Margaryan, A, et al, Population genomics of the Viking world (2020)
McDonald, I., U106 explored: its relationships, geography and history (2015)
McNeill, J., McNeill and Beyond – A Memoir (website)
Micheletti, S.J. et al, Genetic Consequences of the Transatlantic Slave Trade in the Americas (2020)
Myres, N.M. et al, A major Y-chromosome haplogroup R1b Holocene era founder effect in Central and Western Europe (2011)
Myres, N.M. et al, Y-chromosome Short Tandem Repeat DYS458.2 Non-consensus Alleles Occur Independently in Both Binary Haplogroups J1-M267 and R1b3-M405 (2007)
O’Sullivan, K., DNA study reveals fate of Irish women taken by Vikings as slaves to Iceland. Ancient Iceland settlers had even split of Norse and Gaelic ancestry (2018)
Reich, D., Who we are and how we got here. Ancient DNA and the New Science of the Human Past (2018)
Seguin-Orlando, A. et al, Genomic structure in Europeans dating back at least 36,200 years (2014)
Shaw, J., Who Killed the Men of England? (2009)
Sijens, D., Friese bewegers: Geert Ruiter. Pleiter foar boerebelangen yn it ferkearde tiidrek (2016)
Thomas, M. G., Stumpf, M. P. & Harke, H., Evidence for an apartheid-like social structure in early Anglo-Saxon England (2006)
Weale, M.E. et al, Y Chromosome Evidence for Anglo-Saxon Mass Migration (2002)
Wilson, J.F., Weiss, D.A., Richards, M., Thomas, M.G., Bradman, N. & Goldstein, D.B., Genetic evidence for different male and female roles during cultural transitions in the British Isles (2001)
Zerjal, T. et al, Geographical, Linguistic, and Cultural Influences on Genetic Diversity: Y-Chromosomal Distribution in Northern European Populations (2001)